Prev. | 

RIKEN DNA Bank Human Resource - C8orf33

Gene ID NCBI Gene 65265 |  KEGG hsa:65265
Gene Symbol C8orf33
Protein Name chromosome 8 open reading frame 33
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005965 IRAK014P05 pCMV-SPORT6 BC015181 NM_023080 Partial/var
HGY090674 IRAL026L10 pOTB7 BC010001 NM_023080 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071380 ARe78H12 pKA1U5 NM_023080.2  
GGCGCCCCGCGTAGTTCCGGTGGCGACTGCGGCGCATGGCGGCCCTGGGACATCTTGCTG
HKR346455 RBb66C07 pGCAP1 NM_023080.2  
GGTGGCGACTGCGGCGCATGGCGGCCCTGGGACATCTTGCTGGGGAGGCAGCGGCGGCCC
HKR346479 RBb66D07 pGCAP1 NM_023080.2  
GGTGGCGACTGCGGCGCATGGCGGCCCTGGGACATCTTGCTGGGGAGGCAGCGGCGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl