Prev. | 

RIKEN DNA Bank Human Resource - RSRC2

Gene ID NCBI Gene 65117 |  KEGG hsa:65117
Gene Symbol RSRC2
Protein Name arginine and serine rich coiled-coil 2
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005238 IRAK013B14 pCMV-SPORT6 BC008684 NM_198262 Full
HGY067352 IRAK168G08 pBluescriptR BC067773 NM_198262 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR173612 ARi34A12 pGCAP10 NM_023012.4  
GGCGCGAGCGATTTAGTCTGAGGCGAAGCTTCGGAGCGGCCGGTACTGTTGAAAGCGACA
HKR381749 RBd54G05 pGCAP10 NM_023012.4  
TGGGCGCGAGCGATTTAGTCTGAGGCGAAGCTTCGGAGCGGCCGGTACTGTTGAAAGCGA
HKR385353 RBd63G09 pGCAP10 NM_023012.4  
GGTGCCATCCGGGTCTCTCGCGCGAGCGATTTAGTCTGAGGCGAAGCTTCGGAGCGGCCG
HKR386970 RBd67H02 pGCAP10 NM_023012.4  
GGTCTGAGGCGAAGCTTCGGAGCGGCCGGTACTGTTGAAAGCGACAAGTGGAGGCGCCGC
HKR461934 RBdS154N22 pGCAP10 NM_023012.4  
GGCGCGAGCGATTTAGTCTGAGGCGAAGCTTCGGAGCGGCCGGTACTGTTGAAAGCGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl