DNA Bank Top |  KEGG KO K20182 > 

RIKEN DNA Bank Human Resource - VPS33A

Gene ID NCBI Gene 65082 |  KEGG hsa:65082
Gene Symbol VPS33A
Protein Name VPS33A core subunit of CORVET and HOPS complexes
Synonyms MPSPS

Link

Ortholog resource in our bank

  VPS33A


External database

human VPS33A

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19783 pMXsIP-GFP-VPS33A Retroviral vector for stable expression of human VPS33A with N-terminal GFP.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005268 IRAK013C20 pCMV-SPORT6 BC016617 NM_022916 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR430161 RBdS075G17 pGCAP10 NM_022916.4  
GCGTCCGTGGTCCTCCCGTAGGAACCGGCGGACTCGGTTGGCGTTGTGGGGCAGGGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2025.03.28

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl