Prev. |  KEGG KO K02911 > 

RIKEN DNA Bank Human Resource - MRPL32

Gene ID NCBI Gene 64983 |  KEGG hsa:64983
Gene Symbol MRPL32
Protein Name mitochondrial ribosomal protein L32
Synonyms HSPC283|L32mt|MRP-L32|bMRP-59b
Ortholog resource in our bank

  MRPL32

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010593 IRAK026I01 pCMV-SPORT6 BC013147 NM_031903 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047349 ARe18G05 pKA1U5 NM_031903.2  
GGGGACCGGGGCGGTCTTCCAGCAGGGAAAATGGCGCTGGCCATGCTGGTCTTGGTGGTT
HKR184857 ARi62C09 pGCAP10 NM_031903.2  
GGGTCTTCCAGCANGAAAATGGCGCTGGCCATGCTGGTCTTGGTGGTTTCGCCGTGNCTG
HKR235555 ARiS088O19 pGCAP10 NM_031903.2  
GGAAAATGGCGCTGGCCATGCTGGTCTTGGTGGTTTCGCCGTGGTCTGCGGCCCGGGGAG
HKR390831 RBd77B07 pGCAP10 NM_031903.2  
GAGCAGGGAAAATGGCGCTGGCCATGCTGGTCTTGGTGGTTTCGCCGTGGTCTGCGGCCC
HKR453171 RBdS132P11 pGCAP10 NM_031903.2  
GCTTCCAGCAGGGAAAATGGCGCTGGCCATGCTGGTCTTGGTGGTTTCGCCGTGGTCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl