Prev. |  KEGG KO K02914 > 

RIKEN DNA Bank Human Resource - MRPL34

Gene ID NCBI Gene 64981 |  KEGG hsa:64981
Gene Symbol MRPL34
Protein Name mitochondrial ribosomal protein L34
Synonyms L34mt
Ortholog resource in our bank

  MRPL34

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011603 IRAK029A03 pCMV-SPORT6 BC021801 NM_023937 Full
HGY083093 IRAL007M05 pOTB7 BC000071 NM_023937 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208194 ARiS020I02 pGCAP10 NM_023937.3  
GGCTCCGGAATCGCCCGCAGCCGGTACTGCGGGACCCACTGCGGATATGGCTGTCTTGGC
HKR208225 ARiS020J09 pGCAP10 NM_023937.3  
GGCTCCGGAATCGCCCGCAGCCGGTACTGCGGGACCCACTGCGGATATGGCTGTCTTGGC
HKR428068 RBdS070C20 pGCAP10 NM_023937.3  
GGGCTCTGGGCTCCGGAATCGCCCGCAGCCGGTACTGCGGGACCCACTGCGGATATGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl