Prev. |  KEGG KO K02956 > 

RIKEN DNA Bank Human Resource - MRPS15

Gene ID NCBI Gene 64960 |  KEGG hsa:64960
Gene Symbol MRPS15
Protein Name mitochondrial ribosomal protein S15
Synonyms DC37|MPR-S15|RPMS15|S15mt
Ortholog resource in our bank

  MRPS15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097224 IRAL043A24 pOTB7 BC031336 NM_031280 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR375625 RBd39B01 pGCAP10 NM_031280.3  
GAACCCGGTCCGTGCCGCAAAGCGAACGGCGGCCGCGGCGCGGGCCCCGCGGGGGTTAGA
HKR391347 RBd78G03 pGCAP10 NM_031280.3  
GGGCCGCGGCGCGGGCCCCGCGGGGGTTAGAGGTCACCATGCTGAGGGTCGCGTGGAGGA
HKR432651 RBdS081K11 pGCAP10 NM_031280.3  
GAACCCGGTCCGTGCCGCAAAGCGAACGGCGGCCGCGGCGCGGGCCCCGCGGGGGTTAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl