Prev. | 

RIKEN DNA Bank Human Resource - STAG3L4

Gene ID NCBI Gene 64940 |  KEGG hsa:64940
Gene Symbol STAG3L4
Protein Name stromal antigen 3-like 4 (pseudogene)
Synonyms STAG3L4P
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090092 IRAL025D20 pOTB7 BC026058 XM_935815 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079253 ARe98C05 pKA1U5 NM_022906.2  
GGGGAGATGTCCGCCCCCAGNTCGTAGCCTCGGACGGTTTTCTGAGCGTTGGTGTTTGGC
HKR234304 ARiS085M16 pGCAP10 NM_022906.2  
GGGGTCACAAGGGAGATGTCCGCCCCCAGTCGTAGCCTCGGACGGTTTCTGAGCGTTGGT
HKR376031 RBd40B07 pGCAP10 NM_022906.2  
TTGACACAAGGGAGATGTCCGCCCCCAGTCGTAGCCTCGGACGGTTTCTGAGCGTTGGTG
HKR386947 RBd67G03 pGCAP10 NM_022906.2  
GAGGGTCACAAGGGAGATGTCCGCCCCCAGTCGTAGCCTCGGACGGTTTCTGAGCGTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl