RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - LPIN3

Gene ID	NCBI Gene 64900 \| KEGG hsa:64900
Gene Symbol	LPIN3
Protein Name	lipin 3
Synonyms	LIPN3L\|SMP2\|dJ620E11.2

Ortholog resource in our bank

  LPIN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR333769	RBb34H01	pGCAP1	NM_001301860.2	Partial
HKR333769	GGCAGGGGCGGGGTCTTTCCAGGGAGTGGAGCCTGGGCAGATTGGGGCCTGTGGAGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv

2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl