Prev. | 

RIKEN DNA Bank Human Resource - NIBAN2

Gene ID NCBI Gene 64855 |  KEGG hsa:64855
Gene Symbol NIBAN2
Protein Name niban apoptosis regulator 2
Synonyms C9orf88|FAM129B|MEG-3|MINERVA|OC58|bA356B19.6
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001920 IRAK004N08 pCMV-SPORT6 BC001979 NM_022833 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE121247 M01C103B23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE121295 M01C103D23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE121343 M01C103F23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE121391 M01C103H23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE121439 M01C103J23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE121487 M01C103L23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE121535 M01C103N23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE121583 M01C103P23 pDONR221 06_12-C12 BC067366 NM_001035534  
HGE125243 M01C113B19 pDONR221 06-2_05-C10 BC067366 NM_001035534  
HGE125291 M01C113D19 pDONR221 06-2_05-C10 BC067366 NM_001035534  
HGE125339 M01C113F19 pDONR221 06-2_05-C10 BC067366 NM_001035534  
HGE125387 M01C113H19 pDONR221 06-2_05-C10 BC067366 NM_001035534  
HGE125435 M01C113J19 pDONR221 06-2_05-C10 BC067366 NM_001035534  
HGE125483 M01C113L19 pDONR221 06-2_05-C10 BC067366 NM_001035534  
HGE125531 M01C113N19 pDONR221 06-2_05-C10 BC067366 NM_001035534  
HGE125579 M01C113P19 pDONR221 06-2_05-C10 BC067366 NM_001035534  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066832 ARe67B08 pKA1U5 NM_022833.2  
GGGAGCGGAAGCCGCAGCCGGGCGGCGGGAGCGGCGGGAGCGGCGGGAGCGGGGGAAGCA
HKR175773 ARi39H05 pGCAP10 NM_022833.2  
GGGCCGGCTGGAGGGACGGGGCCCGACCGGGAGCGGAGCCGGAGCGGAAGCCGCAGCCGG
HKR397698 RBd94E02 pGCAP10 NM_022833.2  
GGGGGCCGAGGGCAGGGAGGGGGACAAGGCGGCCGGCTGGAGGGACGGGGCCCCACCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl