Prev. | 

RIKEN DNA Bank Human Resource - SPATA20

Gene ID NCBI Gene 64847 |  KEGG hsa:64847
Gene Symbol SPATA20
Protein Name spermatogenesis associated 20
Synonyms HEL-S-98|SSP411|Tisp78
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006006 IRAK015A06 pCMV-SPORT6 BC017468 NM_022827 Partial/var
HGX056245 IRAK140K05 pCMV-SPORT6 BC065526 NM_022827 Full/var
HGY097097 IRAL042M09 pOTB7 BC025255 NM_022827

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162804 ARi07A04 pGCAP10 NM_022827.2  
GGTCCTCAGCGGCCGGGCCCACGGCCCCGAGCAGCCATGCTGGGCGCGCGGGCCTGGTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl