Prev. |  KEGG KO K00181 > 

RIKEN DNA Bank Human Resource - PORCN

Gene ID NCBI Gene 64840 |  KEGG hsa:64840
Gene Symbol PORCN
Protein Name porcupine O-acyltransferase
Synonyms DHOF|FODH|MG61|PORC|PPN
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  PORCN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095680 IRAL039D08 pOTB7 BC019080 NM_203476 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234827 ARiS087B03 pGCAP10 NM_022825.2  
GGGGAGCCGCTGCTGGTCCCGGCCTTGCGGCCTGCGGGGGAGGCTGCCCGGAGGAGGCAG
HKR382973 RBd57H05 pGCAP10 NM_022825.2  
GCTGCGGGGGAGGCTGNCCGGAGGAGGCAGCGGCGGCGGNNNNNNNNNNNCGGTCCNCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl