Prev. |  KEGG KO K10283 > 

RIKEN DNA Bank Human Resource - FBXL17

Gene ID NCBI Gene 64839 |  KEGG hsa:64839
Gene Symbol FBXL17
Protein Name F-box and leucine rich repeat protein 17
Synonyms FBXO13|Fbl17|Fbx13
Ortholog resource in our bank

  FBXL17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010575 IRAK026H07 pCMV-SPORT6 BC018548 NM_022824 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE118811 M01C097A11 pDONR221 IMS12-A06 AK126722 NM_022824  
HGE118859 M01C097C11 pDONR221 IMS12-A06 AK126722 NM_022824  
HGE118907 M01C097E11 pDONR221 IMS12-A06 AK126722 NM_022824  
HGE118955 M01C097G11 pDONR221 IMS12-A06 AK126722 NM_022824  
HGE119003 M01C097I11 pDONR221 IMS12-A06 AK126722 NM_022824  
HGE119051 M01C097K11 pDONR221 IMS12-A06 AK126722 NM_022824  
HGE119099 M01C097M11 pDONR221 IMS12-A06 AK126722 NM_022824  
HGE119147 M01C097O11 pDONR221 IMS12-A06 AK126722 NM_022824  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276462 ARiS191C14 pGCAP10 NM_001163315.2  
GGCCCCCACCGAAGCTGGCGGGGACGCTGTCCGAGCCGGGGGCACCGCCCCCTTGTCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl