DNA Bank Top |  KEGG KO K20168 > 

RIKEN DNA Bank Human Resource - TBC1D15

Gene ID NCBI Gene 64786 |  KEGG hsa:64786
Gene Symbol TBC1D15
Protein Name TBC1 domain family member 15
Synonyms RAB7-GAP
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  TBC1D15


External database

human TBC1D15

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB15002 pEGFP-C1-human TBC1D15 Expression vector of human TBC1 domain family member 15 (TBC1D15), fused with N-terminal EGFP, CMV promoter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013611 IRAK034A11 pBluescriptR BC028352 NM_022771

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2025Apr02.csv
GNP_full_IRAL_2025Apr02.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082037 M01C005B13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE082085 M01C005D13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE082133 M01C005F13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE082181 M01C005H13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE082229 M01C005J13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE082277 M01C005L13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE082325 M01C005N13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE082373 M01C005P13 pDONR221 04-134-2_3-C07 AK022147 NM_022771  
HGE086407 M01C016A07 pDONR221 FLJ05-E04 AK022147 NM_022771  
HGE086455 M01C016C07 pDONR221 FLJ05-E04 AK022147 NM_022771  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR120931 ARh02F11 pGCAP1 NM_022771.4  
AAATGTGGATTACCAGGCACGCGCAGGAAACATGGCGGCNNNNNNTGTTGTGA
HKR386148 RBd65G04 pGCAP10 NM_022771.4  
GGGCGGCGGGTGTTGTGAGCGGGAAGATTATATATGAACAAGAAGGAGTATATATTCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_20250404.csv
NRCDhumcloneList_RB_20250404.csv


2025.05.14

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl