Prev. |  KEGG KO K18340 > 

RIKEN DNA Bank Human Resource - AEN

Gene ID NCBI Gene 64782 |  KEGG hsa:64782
Gene Symbol AEN
Protein Name apoptosis enhancing nuclease
Synonyms ISG20L1|pp12744
Ortholog resource in our bank

  AEN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008345 IRAK020O09 pCMV-SPORT6 BC020988 NM_022767
HGY084527 IRAL011F07 pOTB7 BC005164 NM_022767 Partial/var
HGY091681 IRAL029D09 pOTB7 BC014407 NM_022767 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR121322 ARh03F02 pGCAP1 NM_022767.3  
GGGACGCCACGTGCAGACCGGAAGAGACACGCGGGGCTTCAGGCTGCTGCCCCA
HKR403002 RBdS007I10 pGCAP10 NM_022767.3  
GAGAGACACGCGGGGCTTCAGGCTGCTGCCCCATTGGAAGATTACTCCCCAGGCTTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl