Prev. |  KEGG KO K19947 > 

RIKEN DNA Bank Human Resource - MICAL1

Gene ID NCBI Gene 64780 |  KEGG hsa:64780
Gene Symbol MICAL1
Protein Name microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms MICAL|MICAL-1|NICAL
Ortholog resource in our bank

  MICAL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044152 IRAK110G08 pCMV-SPORT6 BC052983 NM_022765 Full/var
HGY090777 IRAL026P17 pOTB7 BC009972 NM_022765 Full/var
HGY097977 IRAL044P17 pOTB7 BC042144 NM_022765 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051354 ARe28G10 pKA1U5 NM_022765.3  
GGGCCCCTCCCGGCTTCGGAGCCGCCGCCACTCGTCTCTGCCCAGCTGCTGCCCTCCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl