Prev. | 

RIKEN DNA Bank Human Resource - FAM160B2

Gene ID NCBI Gene 64760 |  KEGG hsa:64760
Gene Symbol FAM160B2
Protein Name family with sequence similarity 160 member B2
Synonyms RAI16
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008779 IRAK021P19 pCMV-SPORT6 BC012865 NM_022749 Partial/var
HGY090005 IRAL025A05 pOTB7 BC013350 NM_022749 Partial/var
HGY098887 IRAL047D15 pOTB7 BC052237 NM_022749 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405335 RBdS013F15 pGCAP10 NM_022749.5  
GGGGGCTGCCTCCTCCGCCTAGAGCGCTGCCGCCGCCGCTTTCGCCCGGGAGCCGGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl