Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATPAF1

Gene ID (NCBI) 64756
Gene Symbol ATPAF1
Protein Name ATP synthase mitochondrial F1 complex assembly factor 1
Synonyms ATP11|ATP11p
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX066651 IRAK166K11 pCMV-SPORT6 BC071731 NM_022745 Full
HGY088522 IRAL021F02 pDNR-LIB BC008498 NM_022745 Full
HGY096264 IRAL040K24 pOTB7 BC018781 NM_022745 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR186525 ARi66F05 pGCAP10 NM_022745.3
GGACGCGCCTGAGGAGGAGGAGGAGGCGGGGGCGGCCATGGCTGCTGTGGTGGTGGCGGC
HKR079749 ARe99G05 pKA1U5 NM_022745.3
GAGGCGGGGGCGGCCATGGCTGCTGTGGTGGTGGCGGCTGCGGGTGGCGCGGGACCGGCG
HKR279258 ARiS198C10 pGCAP10 NM_022745.3
TGGATGGAGCGGGCGCGCGGGCCGCGGGCCGAGGCCGACGCGCCTGAGGAGGAGGAGGAG
HKR324033 RBb10B09 pKA1U5 NM_022745.3
GGCGCCTGAGGAGGANGAGGANGCGGGGGCGGCCATGGCTGCTGTGGTGGTGGCGNCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl