Prev. | 

RIKEN DNA Bank Human Resource - METTL17

Gene ID NCBI Gene 64745 |  KEGG hsa:64745
Gene Symbol METTL17
Protein Name methyltransferase like 17
Synonyms METT11D1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087209 IRAL018A09 pOTB7 BC005053 NM_022734 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR185697 ARi64E01 pGCAP10 NM_022734.2  
HKR321779 RBb04H11 pKA1U5 NM_022734.2  
GGTTTCCGGTTCGCCTCCGGAGCCATGGCGGCGGCACTGAAGTGTCTACTGACATTAGGA
HKR336156 RBb40G12 pGCAP1 NM_022734.2  
TTTTCCGGTTCGCCTCCGGAGCCATGGCGGCGGCACTGAAGTGTCTACTGACATTAGGAA
HKR373632 RBd34B08 pGCAP10 NM_022734.2  
GGTTTCCGGTTCGCCTCCGGAGCCATGGCGGCGGCACTGAAGTGTCTACTGACATTAGGA
HKR398978 RBd97H10 pGCAP10 NM_022734.2  
GAGCCATGGCGGCGGCACTGAAGTGTCTACTGACATTAGGAAGATGGTGCCCCGGCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl