Prev. | 

RIKEN DNA Bank Human Resource - INF2

Gene ID NCBI Gene 64423 |  KEGG hsa:64423
Gene Symbol INF2
Protein Name inverted formin, FH2 and WH2 domain containing
Synonyms C14orf151|C14orf173|CMTDIE|FSGS5|pp9484
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056554 IRAK141G10 pCMV-SPORT6 BC064828 NM_001031714 Partial/var
HGY082123 IRAL005F03 pOTB7 BC008756 NM_001031714 Partial
HGY087582 IRAL018P22 pOTB7 BC006173 NM_032714

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218188 ARiS045H20 pGCAP10 NM_032714.1  
GGNGGAGCGCGGCAGTGGGCGCCGGCTGCCCGCAGCCCCTGACCCGGCCCCGGACGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl