Prev. |  KEGG KO K06814 > 

RIKEN DNA Bank Human Resource - CDH24

Gene ID NCBI Gene 64403 |  KEGG hsa:64403
Gene Symbol CDH24
Protein Name cadherin 24
Synonyms CDH11L
Ortholog resources KEGG ortholog (KEGG orthology K06814) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR475004 RBdS187I12 pGCAP10 NM_022478.3 done
TGGCGGAGCCGCCTCGCTCCTCCGCAGGCGGAGTCTTCTTCCCCCGCCCCCTCCGTCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl