Prev. |  KEGG KO K09220 > 

RIKEN DNA Bank Human Resource - IKZF5

Gene ID NCBI Gene 64376 |  KEGG hsa:64376
Gene Symbol IKZF5
Protein Name IKAROS family zinc finger 5
Synonyms PEGASUS|ZNFN1A5
Ortholog resource in our bank

  IKZF5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY012939 IRAK032F19 pBluescriptR BC022564 NM_022466 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037271 W01A093C23 pENTR-TOPO IRAK032F19 BC022564 NM_022466  
HGE037311 W01A093E15 pENTR-TOPO IRAK032F19 BC022564 NM_022466  
HGE037313 W01A093E17 pENTR-TOPO IRAK032F19 BC022564 NM_022466  
HGE044488 W01A111D16 pENTR-TOPO IRAK032F19 BC022564 NM_022466  
HGE044494 W01A111D22 pENTR-TOPO IRAK032F19 BC022564 NM_022466  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR430187 RBdS075H19 pGCAP10 NM_022466.5  
GGGGAAGGGAGTCGGAGACACAACAAAGATGGCGGCGGTGACTGTGACGGTGACGAAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl