Prev. |  KEGG KO K17609 > 

RIKEN DNA Bank Human Resource - NXN

Gene ID NCBI Gene 64359 |  KEGG hsa:64359
Gene Symbol NXN
Protein Name nucleoredoxin
Synonyms NRX|RRS2|TRG-4
Ortholog resource in our bank

  NXN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056402 IRAK141A02 pCMV-SPORT6 BC063828 NM_022463 Partial
HGX066726 IRAK166N14 pCMV-SPORT6 BC073845 NM_022463 Partial/var
HGY090548 IRAL026G04 pOTB7 BC009327 NM_022463 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE051164 W01A127P04 pENTR-TOPO flj0032c05 AK027451 NM_022463  
HGE051166 W01A127P06 pENTR-TOPO flj0032c05 AK027451 NM_022463  
HGE051168 W01A127P08 pENTR-TOPO flj0032c05 AK027451 NM_022463  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420625 RBdS051J09 pGCAP10 NM_022463.3  
GGGGCTCTGCTCTCCCCAGCGCCTGCCGCCGACGCCGCCGCCTCCTCCCGCCGCGCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl