Prev. |  KEGG KO K12651 > 

RIKEN DNA Bank Human Resource - AZI2

Gene ID NCBI Gene 64343 |  KEGG hsa:64343
Gene Symbol AZI2
Protein Name 5-azacytidine induced 2
Synonyms AZ2|NAP1|TILP
Ortholog resource in our bank

  AZI2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081276 IRAL003D04 pOTB7 BC001139 NM_022461 Partial
HGY084260 IRAL010K20 pOTB7 BC001853 NM_022461 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219668 ARiS049C20 pGCAP10 NM_022461.3  
GCTCCCTCCGGCCCGTGCTGGTCCCGACGGCGGGCCTGGGTCTCGCGCGCGTATTGCTGG
HKR325773 RBb14H05 pKA1U5 NM_022461.3  
TTGGGTTCGCTAACNCCCTCCCAGCTCCCTCGNCCCNTTNACTTCCGGTTTCCTCNCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl