Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AZI2

Gene ID (NCBI) 64343
Gene Symbol AZI2
Protein Name 5-azacytidine induced 2
Synonyms AZ2|NAP1|TILP
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081276 IRAL003D04 pOTB7 BC001139 NM_022461 Partial
HGY084260 IRAL010K20 pOTB7 BC001853 NM_022461 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR219668 ARiS049C20 pGCAP10 NM_022461.3
GCTCCCTCCGGCCCGTGCTGGTCCCGACGGCGGGCCTGGGTCTCGCGCGCGTATTGCTGG
HKR325773 RBb14H05 pKA1U5 NM_022461.3
TTGGGTTCGCTAACNCCCTCCCAGCTCCCTCGNCCCNTTNACTTCCGGTTTCCTCNCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl