Prev. | 

RIKEN DNA Bank Human Resource - HS1BP3

Gene ID NCBI Gene 64342 |  KEGG hsa:64342
Gene Symbol HS1BP3
Protein Name HCLS1 binding protein 3
Synonyms ETM2|HS1-BP3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX019770 IRAK049H02 pCMV-SPORT6 BC027947 NM_022460 Partial
HGX042956 IRAK107G12 pCMV-SPORT6 BC057389 NM_022460 Partial
HGX044057 IRAK110C09 pCMV-SPORT6 BC050636 NM_022460 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173280 ARi33D08 pGCAP10 NM_022460.3  
GAGTCCCCGCCGCCGTCATGCAGTCCCCGGCGGTGCTCGTCACCTCCAGGCGACTTCAGA
HKR205436 ARiS013J20 pGCAP10 NM_022460.3  
GGTCCCCGCCGCCGTCATGCAGTCCCCGGCGGTGCTCGTCACCTCCAGGCGACTTCAGAA
HKR219881 ARiS049L17 pGCAP10 NM_022460.3  
GAGGGCGGGGACGCGGTGACGCGGGCACTGCCGGGTCCCGTGACTGCGCGCCCCGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl