Prev. | 

RIKEN DNA Bank Human Resource - LMBR1

Gene ID NCBI Gene 64327 |  KEGG hsa:64327
Gene Symbol LMBR1
Protein Name limb development membrane protein 1
Synonyms ACHP|C7orf2|DIF14|LSS|PPD2|THYP|TPT|ZRS
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008805 IRAK022A05 pCMV-SPORT6 BC017663 NM_022458 Full
HGX053921 IRAK134N09 pCMV-SPORT6.ccdb BC063649 NM_022458 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040566 W01A101G22 pENTR-TOPO flj0029c01 AK021727 NM_022458  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR398521 RBd96F01 pGCAP10 NM_022458.3  
GAGAGCTGCTCGTCTGAGGCTGCTGAGGCGACGGCCGGTGTCGTGGTCGCGGTACCTGTT
HKR408832 RBdS022B08 pGCAP10 NM_022458.3  
GGAGGCTGCTGAGGCGACGGCCGGTGTCGTGGTCGCGGTACCTGTTCCAACACGGCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl