Prev. |  KEGG KO K23353 > 

RIKEN DNA Bank Human Resource - PDLIM2

Gene ID NCBI Gene 64236 |  KEGG hsa:64236
Gene Symbol PDLIM2
Protein Name PDZ and LIM domain 2
Synonyms MYSTIQUE|SLIM
Ortholog resource in our bank

  PDLIM2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096049 IRAL040C01 pOTB7 BC021556 NM_021630 Full
HGY102864 IRAL057C16 pDNR-LIB BC071774 NM_021630 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049306 ARe23E10 pKA1U5 NM_021630.4  
GAGAGTCGGGTAGACGGCAGCGGGAGCGGTGGCGTNTCCCCGCCTTCCCTCCCTCCCGGG
HKR279523 ARiS198N11 pGCAP10 NM_021630.4  
GAGAGTCGGGTAGACGGCAGCGGGAGCGGTGGCGTCTCCCCGCCTTCCCTCCCTCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl