Prev. |  KEGG KO K10633 > 

RIKEN DNA Bank Human Resource - PJA1

Gene ID NCBI Gene 64219 |  KEGG hsa:64219
Gene Symbol PJA1
Protein Name praja ring finger ubiquitin ligase 1
Synonyms PRAJA1|RNF70
Ortholog resources KEGG ortholog (KEGG orthology K10633) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066438 IRAK166B14 pCMV-SPORT6 BC075803 NM_145119 Full
HGX037296 IRAK093D24 pCMV-SPORT6 BC048323 NM_145119 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR218231 ARiS045J15 pGCAP10 NM_022368.3  
GAGCGGCTCTGGCGGTCGTGGCGGTCGGAGATCCGAGAGCTCTGCTTCTCTGAAAAGCGT
HKR338401 RBb46A01 pGCAP1 NM_022368.3  
GGAGCAGCGGCTCTGGCGGTCGTGGCGGTCGGAGATCCGAGAGCTCTGCTTCTCTGAAAA
HKR342884 RBb57D12 pGCAP1 NM_022368.3  
GGCTGCTGTCTGGCGGGGGAGGAGCTCGGGACCGGGAGCAGCGGCTCTGGCGGTCGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl