Prev. |  KEGG KO K09521 > 

RIKEN DNA Bank Human Resource - DNAJC1

Gene ID NCBI Gene 64215 |  KEGG hsa:64215
Gene Symbol DNAJC1
Protein Name DnaJ heat shock protein family (Hsp40) member C1
Synonyms DNAJL1|ERdj1|HTJ1|MTJ1
Ortholog resource in our bank

  DNAJC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB16047 ERj1N-V5-GFP11 The split-GFP system clone for visualizing organelle contact sites in mammalian cells. probe: V5-GFP11; location: endoplasmic reticulum.
RDB18663 pMM86 pcDNA3.1-ERj1 1-200-V5-GFP1-10 The split-GFP system clone for visualizing organelle contact sites in mammalian cells. probe: V5-GFP1-10; location: endoplasmic reticulum.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096541 IRAL041F21 pDNR-LIB BC030955 NM_022365 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002754 W01A006O18 pENTR-TOPO flj0019b01 AK027263 NM_022365  
HGE002756 W01A006O20 pENTR-TOPO flj0019b01 AK027263 NM_022365  
HGE002760 W01A006O24 pENTR-TOPO flj0019b01 AK027263 NM_022365  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163625 ARi09B01 pGCAP10 NM_022365.3  
GGCAGCCCAGGCGCCGGGCGCTGCCTCTACAGCTGTGTGTAGGCCTGGGGGCGAGGGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.12.23

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl