Prev. |  KEGG KO K15075 > 

RIKEN DNA Bank Human Resource - MMS19

Gene ID NCBI Gene 64210 |  KEGG hsa:64210
Gene Symbol MMS19
Protein Name MMS19 homolog, cytosolic iron-sulfur assembly component
Synonyms CIAO4|MET18|MMS19L|hMMS19
Ortholog resource in our bank

  MMS19

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084612 IRAL011I20 pOTB7 BC006575 NM_022362 Partial/var
HGY085139 IRAL012O03 pOTB7 BC002692 NM_022362 Partial/var
HGY090675 IRAL026L11 pOTB7 BC009396 NM_022362 Partial/var
HGY103705 IRAL059E09 pOTB7 BC080532 NM_022362 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009419 W01A023J03 pENTR-TOPO flj0003a06 AK056581 NM_022362  
HGE009421 W01A023J05 pENTR-TOPO flj0003a06 AK056581 NM_022362  
HGE009423 W01A023J07 pENTR-TOPO flj0003a06 AK056581 NM_022362  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366430 RBd16B06 pGCAP10 NM_022362.4  
GACCGCCCATATCCCCTCCCACGGTCTCTAGTTCGCGTTATGGCCGCTGCCGCGGCTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl