Prev. |  KEGG KO K05542 > 

RIKEN DNA Bank Human Resource - DUS1L

Gene ID NCBI Gene 64118 |  KEGG hsa:64118
Gene Symbol DUS1L
Protein Name dihydrouridine synthase 1 like
Synonyms DUS1|PP3111
Ortholog resource in our bank

  DUS1L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008219 IRAK020J03 pCMV-SPORT6 BC017081 NM_022156 Partial
HGX054049 IRAK135C01 pCMV-SPORT6 BC062566 NM_022156 Full
HGX056159 IRAK140G15 pCMV-SPORT6 BC064918 NM_022156 Full
HGY084728 IRAL011N16 pOTB7 BC003659 NM_022156 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096037 M01C040B13 pDONR221 MGC09-G07 BC064918 NM_022156  
HGE096085 M01C040D13 pDONR221 MGC09-G07 BC064918 NM_022156  
HGE096133 M01C040F13 pDONR221 MGC09-G07 BC064918 NM_022156  
HGE096181 M01C040H13 pDONR221 MGC09-G07 BC064918 NM_022156  
HGE096229 M01C040J13 pDONR221 MGC09-G07 BC064918 NM_022156  
HGE096277 M01C040L13 pDONR221 MGC09-G07 BC064918 NM_022156  
HGE096325 M01C040N13 pDONR221 MGC09-G07 BC064918 NM_022156  
HGE096373 M01C040P13 pDONR221 MGC09-G07 BC064918 NM_022156  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374554 RBd36G10 pGCAP10 NM_022156.3  
GGGAGCCTTGGGCCCGGCTGCGGCCCGGCGGCGGCCCCGGCGCGGTGCGGGCGTTCGCGG
HKR379706 RBd49E10 pGCAP10 NM_022156.3  
GGCGGAGCCTTGGGCCCGGCTGCGGCCCGGCGGCGGCCCCGGCGCGGTGCGGGCGTTCGC
HKR405967 RBdS014P07 pGCAP10 NM_022156.3  
GCCGGTGGCGGCGCGGANCCTTGGGCCCGGCTGCGGCCCGGCGGCGGNCCCGGCGCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl