Prev. |  KEGG KO K14714 > 

RIKEN DNA Bank Human Resource - SLC39A8

Gene ID NCBI Gene 64116 |  KEGG hsa:64116
Gene Symbol SLC39A8
Protein Name solute carrier family 39 member 8
Synonyms BIGM103|CDG2N|LZT-Hs6|PP3105|ZIP8
Ortholog resource in our bank

  SLC39A8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001877 IRAK004L13 pCMV-SPORT6 BC001320 NM_022154 Partial
HGY091920 IRAL029N08 pOTB7 BC012125 NM_022154 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234147 ARiS085G03 pGCAP10 NM_022154.5  
GGTTTCACCGTGTTAGCCAGGATGGTCTCCATCTCCTGACCTCGTGATCCGCCCGCCTCG
HKR176979 ARi42H11 pGCAP10 NM_022154.5  
GGAGTTTCACCGCGGACCTGTCAGAGATACAGAGGTTGTGGGGGCGGGAGACAGAAAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl