Prev. | 

RIKEN DNA Bank Human Resource - MOAP1

Gene ID NCBI Gene 64112 |  KEGG hsa:64112
Gene Symbol MOAP1
Protein Name modulator of apoptosis 1
Synonyms MAP-1|PNMA4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006349 IRAK015O13 pCMV-SPORT6 BC015044 NM_022151 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062080 ARe55D08 pKA1U5 NM_022151.4  
GTAGCTTCCCCGAGCGAGACCAAAACAGGTTGGAANCCNGGCTGGAGCCGGAGCTCCGGC
HKR166825 ARi17B01 pGCAP10 NM_022151.4  
GGGAGCTCCGGCGGCGCGGGTGGCGGCACGTCCCTCCAGGTGGGTGGCTCTCTGGGTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl