Prev. | 

RIKEN DNA Bank Human Resource - MAGEF1

Gene ID NCBI Gene 64110 |  KEGG hsa:64110
Gene Symbol MAGEF1
Protein Name MAGE family member F1
Synonyms MAGE-F1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091041 IRAL027K01 pOTB7 BC010056 NM_022149 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113634 M01C084B10 pDONR221 IMS05-H05 BC010056 NM_022149  
HGE113682 M01C084D10 pDONR221 IMS05-H05 BC010056 NM_022149  
HGE113730 M01C084F10 pDONR221 IMS05-H05 BC010056 NM_022149  
HGE113778 M01C084H10 pDONR221 IMS05-H05 BC010056 NM_022149  
HGE113826 M01C084J10 pDONR221 IMS05-H05 BC010056 NM_022149  
HGE113874 M01C084L10 pDONR221 IMS05-H05 BC010056 NM_022149  
HGE113922 M01C084N10 pDONR221 IMS05-H05 BC010056 NM_022149  
HGE113970 M01C084P10 pDONR221 IMS05-H05 BC010056 NM_022149  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR264680 ARiS161L16 pGCAP10 NM_022149.4  
GGCTCCCTNNACTCCCGCCGTCACTGCCGCTGTCCAACCCCTCCCCCGGGGCTTGCGCGG
HKR362980 RBd07H12 pGCAP10 NM_022149.4  
GACACAAAGCTCCCGCTGCCATTGCTCCCTGTACTCCCGCCGTCACTGCCGCTGTCCAAC
HKR366499 RBd16E03 pGCAP10 NM_022149.4  
GACAAAGCTCCCGCTGCCATTGCTCCCTGTACTCCCGCCGTCACTGCCGCTGTCCAACCC
HKR383770 RBd59H02 pGCAP10 NM_022149.4  
GAGGTTCCGGCTGCTGGCGGCGTTGCGGCCGCAGGTTTGACTCCCGTGCGGTGCGGCCCA
HKR384572 RBd61H04 pGCAP10 NM_022149.4  
CGGCCGGCCGATGGCTCCCTGTACTCCCGCCGTCACTGCCGCTGTCCAACCCCTCCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl