Prev. |  KEGG KO K11503 > 

RIKEN DNA Bank Human Resource - CENPK

Gene ID NCBI Gene 64105 |  KEGG hsa:64105
Gene Symbol CENPK
Protein Name centromere protein K
Synonyms AF5alpha|CENP-K|FKSG14|P33|Solt
Ortholog resources KEGG ortholog (KEGG orthology K11503) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086619 IRAL016J03 pDNR-LIB BC005400 NM_022145 Full
HGY088401 IRAL021A01 pDNR-LIB BC008504 NM_022145

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096411 M01C041A11 pDONR221 MGC10-A06 BC005400 NM_022145 done
HGE096459 M01C041C11 pDONR221 MGC10-A06 BC005400 NM_022145  
HGE096507 M01C041E11 pDONR221 MGC10-A06 BC005400 NM_022145  
HGE096555 M01C041G11 pDONR221 MGC10-A06 BC005400 NM_022145  
HGE096603 M01C041I11 pDONR221 MGC10-A06 BC005400 NM_022145  
HGE096651 M01C041K11 pDONR221 MGC10-A06 BC005400 NM_022145  
HGE096699 M01C041M11 pDONR221 MGC10-A06 BC005400 NM_022145  
HGE096747 M01C041O11 pDONR221 MGC10-A06 BC005400 NM_022145  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336952 RBb42G08 pGCAP1 NM_022145.3  
TTGGCGCAGCGCCGAGGCGACCTGGAGTTTGTGACGCTGTGATGGTCTAGAGGCTGGAGA
HKR416185 RBdS040H17 pGCAP10 NM_022145.3  
TGAAGCGCTTCCTGCGCAGCGCCGAGGCGACCTGGAGTTTGTGACGCTGTGATGGTCTAG
HKR462690 RBdS156M02 pGCAP10 NM_022145.3  
TGAAGCGCTTCCTGCGCAGCGCCGAGGCGACCTGGAGTTTGTGACGCTGTGATGTGTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl