Prev. |  KEGG KO K17928 > 

RIKEN DNA Bank Human Resource - SNX16

Gene ID NCBI Gene 64089 |  KEGG hsa:64089
Gene Symbol SNX16
Protein Name sorting nexin 16
Synonyms -
Ortholog resource in our bank

  SNX16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027617 IRAK069A17 pCMV-SPORT6 BC033630 NM_152836 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094027 M01C035B03 pDONR221 MGC07-C02 BC033630 ENST00000345957  
HGE094075 M01C035D03 pDONR221 MGC07-C02 BC033630 ENST00000345957  
HGE094123 M01C035F03 pDONR221 MGC07-C02 BC033630 ENST00000345957  
HGE094171 M01C035H03 pDONR221 MGC07-C02 BC033630 ENST00000345957  
HGE094219 M01C035J03 pDONR221 MGC07-C02 BC033630 ENST00000345957  
HGE094267 M01C035L03 pDONR221 MGC07-C02 BC033630 ENST00000345957  
HGE094315 M01C035N03 pDONR221 MGC07-C02 BC033630 ENST00000345957  
HGE094363 M01C035P03 pDONR221 MGC07-C02 BC033630 ENST00000345957  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179226 ARi48B02 pGCAP10 NM_022133.3  
CCGGGGAGCAGCTGCTTTTGGGGCGGGGGTGTCACGTGACGCTTCTCGCTGCTGAGGGAG
HKR403056 RBdS007K16 pGCAP10 NM_022133.3  
GAGGAGGCGAAAAGCTGCGGTTAAGGAGAGTCCGGTTTAACCGTCACCGGGAAGCGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl