Prev. |  KEGG KO K01969 > 

RIKEN DNA Bank Human Resource - MCCC2

Gene ID NCBI Gene 64087 |  KEGG hsa:64087
Gene Symbol MCCC2
Protein Name methylcrotonoyl-CoA carboxylase 2
Synonyms MCCB
Ortholog resource in our bank

  MCCC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006183 IRAK015H15 pCMV-SPORT6 BC014897 NM_022132 Full/var
HGX056093 IRAK140D21 pCMV-SPORT6 BC065027 NM_022132 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168802 ARi22A02 pGCAP10 NM_022132.4  
GATATACTTCTATGCAAACGAAGACTGGACCCCCAATCAGTCTGATTGGTTGTGGACAGC
HKR176407 ARi41A07 pGCAP10 NM_022132.4  
GGAGAATCAGAGAAGCCTTCTCTGGGGCTGCAAGGACCTGAGCTCAGCTTCCGCCCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl