Prev. |  KEGG KO K15620 > 

RIKEN DNA Bank Human Resource - GOLPH3

Gene ID NCBI Gene 64083 |  KEGG hsa:64083
Gene Symbol GOLPH3
Protein Name golgi phosphoprotein 3
Synonyms GOPP1|GPP34|MIDAS|Vps74
Ortholog resources KEGG ortholog (KEGG orthology K15620) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027362 IRAK068G18 pCMV-SPORT6 BC033725 NM_022130 Full
HGX053802 IRAK134I10 pCMV-SPORT6 BC063586 NM_022130 Full
HGY091677 IRAL029D05 pOTB7 BC012123 NM_022130 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167253 ARi18C05 pGCAP10 NM_022130.3  
GGGGGTGTTTCGGGGACTGCGGCCACAGGCAGGAAGGCGCTCCTTTCCTGCCCCGCCGAC
HKR264761 ARiS161P01 pGCAP10 NM_022130.3  
GACAGGCAGGAAGGCGCTCCTCTCCTGCCCCGCCGACGCCCGGCCAGCCCGCTTCGCCCT
HKR334106 RBb35E10 pGCAP1 NM_022130.3  
GGCCGCCGCCTCCGCCTTGGAGCTCGGGGTGTTTCGGGGACTGCGGCCACAGGCAGGAAG
HKR372176 RBd30H08 pGCAP10 NM_022130.3  
GTTCGGGGNCTGCGGCCACAGGCAGGAAGGCGCTCCTCTCCTGCCCCGCCGACGCCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl