Prev. |  KEGG KO K11725 > 

RIKEN DNA Bank Human Resource - LHPP

Gene ID NCBI Gene 64077 |  KEGG hsa:64077
Gene Symbol LHPP
Protein Name phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Synonyms HDHD2B
Ortholog resource in our bank

  LHPP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069934 IRAK174N22 pCMV-SPORT6 BC073172 NM_022126 Full/var
HGY089604 IRAL024A04 pOTB7 BC007324 NM_022126 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047236 ARe18B12 pKA1U5 NM_022126.2  
GGCCGGGCGCCATGGCACCGTGGGGCAAGCGGCTGGCTGGCGTGCGCGGGGTGCTGCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl