Prev. |  KEGG KO K20097 > 

RIKEN DNA Bank Human Resource - FKBPL

Gene ID NCBI Gene 63943 |  KEGG hsa:63943
Gene Symbol FKBPL
Protein Name FKBP prolyl isomerase like
Synonyms DIR1|FKBP4|NG7|WISP39
Ortholog resources KEGG ortholog (KEGG orthology K20097) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008443 IRAK021B19 pCMV-SPORT6 BC011966 NM_022110 Full
HGY080865 IRAL002C17 pOTB7 BC004168 NM_022110 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR380532 RBd51F12 pGCAP10 NM_022110.3  
GGCCTCCCGCACCGCGCCCCTCTCCGGCTGCCCTCTCCGCGTGGGGCAAGGCTCCGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl