Prev. |  KEGG KO K00710 > 

RIKEN DNA Bank Human Resource - GALNT11

Gene ID NCBI Gene 63917 |  KEGG hsa:63917
Gene Symbol GALNT11
Protein Name polypeptide N-acetylgalactosaminyltransferase 11
Synonyms GALNAC-T11|GALNACT11
Ortholog resource in our bank

  GALNT11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053412 IRAK133I20 pBluescript BC059377 NM_022087 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071379 ARe78H11 pKA1U5 NM_022087.2  
GGTCACGCGGCGCCGGCGGACGCGCGGCGCTGGGCGGAGGCAGCGGCTCGGGGACTGGGC
HKR383676 RBd59D04 pGCAP10 NM_022087.2  
GGTCACGCGGCGCCGGCGGACGCGCGGCGCTGGGCGGAGGCAGCGGCTCGGGGACTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl