Prev. | 

RIKEN DNA Bank Human Resource - HEATR6

Gene ID NCBI Gene 63897 |  KEGG hsa:63897
Gene Symbol HEATR6
Protein Name HEAT repeat containing 6
Synonyms ABC1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277728 ARiS194F08 pGCAP10 NM_022070.4 done
GGCCCCCCCCGCCCGTANAAAAGATGGCTGCTGTGCAAGTTGTCGGTTCGTGGCCTTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl