Prev. | 

RIKEN DNA Bank Human Resource - VIPAS39

Gene ID NCBI Gene 63894 |  KEGG hsa:63894
Gene Symbol VIPAS39
Protein Name VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Synonyms C14orf133|SPE-39|SPE39|VIPAR|VPS16B|hSPE-39
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006294 IRAK015M06 pCMV-SPORT6 BC015054 NM_022067

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061698 ARe54E02 pKA1U5 NM_022067.2  
GACAGCCTGAATAGAAGGGCTGGTCCAGCGGCGGCGGAGGCTGGCGCTGTCCTGAGAGGG
HKR276767 ARiS191P07 pGCAP10 NM_022067.2  
GAAGCTGCACAGCCTGAATAGAAGGGCTGGTCCAGCGGCGGCGGAGGCTGGCGCTGTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl