Prev. |  KEGG KO K13698 > 

RIKEN DNA Bank Human Resource - ABHD4

Gene ID NCBI Gene 63874 |  KEGG hsa:63874
Gene Symbol ABHD4
Protein Name abhydrolase domain containing 4
Synonyms ABH4
Ortholog resource in our bank

  ABHD4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045305 ARe13E09 pKA1U5 NM_022060.2  
GAGGCTTGTTTACTATGGCCGATGATCTGGAGCAGCAGTCTCAAGGCTGGCTGAGTAGCT
HKR398098 RBd95E02 pGCAP10 NM_022060.2  
GAAGGCTTGTTTACTATGGCCGATGATCTGGAGCAGCAGTCTCAAGGCTGGCTGAGTAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl