RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SRR

Gene ID	NCBI Gene 63826 \| KEGG hsa:63826
Gene Symbol	SRR
Protein Name	serine racemase
Synonyms	ILV1\|ISO1

Ortholog resource in our bank

  SRR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR402883	RBdS007D11	pGCAP10	NM_021947.1
HKR402883	GGTGCGCAGAGGTGCGGCCGGGGAGGCGCGCGGAGGCTGGAGCTGGAGGCGCGGCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl