Prev. | 

RIKEN DNA Bank Human Resource - GAS5

Gene ID NCBI Gene 60674 |  KEGG hsa:60674
Gene Symbol GAS5
Protein Name growth arrest specific 5 (non-protein coding)
Synonyms NCRNA00030|SNHG2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029670 IRAK074C22 pBluescriptR BC038733 NR_002578
HGX069745 IRAK174G01 pCMV-SPORT6 BC070486 NR_002578

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045225 ARe13B01 pKA1U5 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR065376 ARe63H08 pKA1U5 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR066858 ARe67C10 pKA1U5 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR074898 ARe87E02 pKA1U5 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR170029 ARi25B05 pGCAP10 NR_002578.2  
GCCTCTGATGAAGCCTGTGTTGGTAGGGACATCTGAGAGTAATGATGAATGCCAACCGCT
HKR174528 ARi36F08 pGCAP10 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR181700 ARi54E04 pGCAP10 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR208051 ARiS020C03 pGCAP10 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR238447 ARiS096B23 pGCAP10 NR_002578.2  
GCTTTTCNAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR264488 ARiS161D16 pGCAP10 NR_002578.2  
GCCTGGACCAGCTTAATGGTTCNNCTCCTGGTAACGTTTTTATCCATGGATGACTTGCTT
HKR332505 RBb31E09 pGCAP1 NR_002578.2  
HKR333276 RBb33D04 pGCAP1 NR_002578.2  
TGGGCTTTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAG
HKR381345 RBd53G01 pGCAP10 NR_002578.2  
GTTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR386905 RBd67E09 pGCAP10 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR388904 RBd72E08 pGCAP10 NR_002578.2  
TGACTGTCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCA
HKR394832 RBd87B08 pGCAP10 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG
HKR405312 RBdS013E16 pGCAP10 NR_002578.2  
GCTTTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGT
HKR409167 RBdS022P07 pGCAP10 NR_002578.2  
GGTCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGT
HKR462463 RBdS156C15 pGCAP10 NR_002578.2  
GCTTTTCGAGGTAGGAGTCGACTCCTGTGAGGTATGGTGCTGGGTGCAGATGCAGTGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl