Prev. |  KEGG KO K20316 > 

RIKEN DNA Bank Human Resource - SCOC

Gene ID NCBI Gene 60592 |  KEGG hsa:60592
Gene Symbol SCOC
Protein Name short coiled-coil protein
Synonyms HRIHFB2072|SCOCO|UNC-69
Ortholog resource in our bank

  SCOC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008526 IRAK021F06 pCMV-SPORT6 BC016511 NM_032547 Partial
HGY100602 IRAL051I10 pDNR-LIB BC062684 NM_032547 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050132 ARe25F12 pKA1U5 NM_032547.2  
GAGGTGTCGGCCGGATCCCTCCTTCTCCCGGCGCCTCAAGCGGAAGACCATTCCTCAAGA
HKR052905 ARe32E09 pKA1U5 NM_032547.2  
TGTTTCTCCCGGCGCCTCAAGCGGAAGACCATTCCTCAAGAATTTTGTATCCAAGGCCCA
HKR322106 RBb05E10 pKA1U5 NM_032547.2  
TGGTCCAGTGTCCCGGCCTGAGGTGTCGGCCGGATCCCTCCTTCTCCCGGCGCCTCAAGC
HKR428051 RBdS070C03 pGCAP10 NM_032547.2  
GAGTTGGTCCAAGTGTCCCGGCCTGAGGTGTCGGCCGGATCCCTCCTTCTCCCGGCGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl