Prev. |  KEGG KO K20823 > 

RIKEN DNA Bank Human Resource - NAA35

Gene ID NCBI Gene 60560 |  KEGG hsa:60560
Gene Symbol NAA35
Protein Name N-alpha-acetyltransferase 35, NatC auxiliary subunit
Synonyms EGAP|MAK10|MAK10P|bA379P1.1
Ortholog resource in our bank

  NAA35

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR013774 ARa34H06 pKA1U5 NM_024635.4 Parcial done
TTGCTCGCTCGTGTGTCCGAGAGCCGCAGCCCCCCGCGCGTGTGGCAGATCCTGGGGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl