Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAA35

Gene ID (NCBI) 60560
Gene Symbol NAA35
Protein Name N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Synonyms EGAP|MAK10|MAK10P|bA379P1.1
Databases KEGG hsa:60560 |  NCBI Gene 60560
Featured content Ortholog resources in the DNA Bank (KEGG orthology K20823)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR013774 ARa34H06 pKA1U5 NM_024635.3  
TTGCTCGCTCGTGTGTCCGAGAGCCGCAGCCCCCCGCGCGTGTGGCAGATCCTGGGGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl