Prev. |  KEGG KO K12948 > 

RIKEN DNA Bank Human Resource - SPCS3

Gene ID NCBI Gene 60559 |  KEGG hsa:60559
Gene Symbol SPCS3
Protein Name signal peptidase complex subunit 3
Synonyms PRO3567|SPC22/23|SPC3|YLR066W
Ortholog resource in our bank

  SPCS3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037457 IRAK093K17 pCMV-SPORT6 BC047290 NM_021928 Full
HGX046192 IRAK115H24 pCMV-SPORT6 BC053883 NM_021928 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218096 ARiS045D24 pGCAP10 NM_021928.3  
GGCCGGTCCGCCGCCGGAACGGGAGCCTGGGTGTGCGTGTGGAGTCCGGACTCGTGGGAG
HKR235471 ARiS088L07 pGCAP10 NM_021928.3  
GGCGCTCCCGGAACGCGCGCACTGCAGACGGCGCGGATCGCAGGGAGCCGGTCCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl