Prev. |  KEGG KO K00784 > 

RIKEN DNA Bank Human Resource - ELAC2

Gene ID NCBI Gene 60528 |  KEGG hsa:60528
Gene Symbol ELAC2
Protein Name elaC ribonuclease Z 2
Synonyms COXPD17|ELC2|HPC2
Ortholog resource in our bank

  ELAC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080861 IRAL002C13 pOTB7 BC004158 NM_018127 Full
HGY083809 IRAL009I17 pOTB7 BC001939 NM_018127 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025684 W01A064D12 pENTR-TOPO flj0022h19 AK094687 NM_018127  
HGE033007 W01A082I15 pENTR-TOPO flj0022h19 AK094687 NM_018127  
HGE033011 W01A082I19 pENTR-TOPO flj0022h19 AK094687 NM_018127  
HGE033013 W01A082I21 pENTR-TOPO flj0022h19 AK094687 NM_018127  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219869 ARiS049L05 pGCAP10 NM_018127.5  
GGCTTTCTCAGTTTTGGTGGAGACGGGCGCATGTGGGCGCTTTGCTCGCTGCTGCGGTCC
HKR279294 ARiS198D22 pGCAP10 NM_018127.5  
HKR335325 RBb38F05 pGCAP1 NM_018127.5  
GAGGTGACCGGCGGCTTTCTCAGTTTTGGTGGAGACGGGCGCATGTGGGCGCTTTGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl