Prev. | 

RIKEN DNA Bank Human Resource - AGBL5

Gene ID NCBI Gene 60509 |  KEGG hsa:60509
Gene Symbol AGBL5
Protein Name ATP/GTP binding protein like 5
Synonyms CCP5|RP75
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081319 IRAL003E23 pOTB7 BC007415 NM_021831 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100017 M01C050A17 pDONR221 MGC14-E09 BC007415 NM_001035506  
HGE100065 M01C050C17 pDONR221 MGC14-E09 BC007415 NM_001035506  
HGE100113 M01C050E17 pDONR221 MGC14-E09 BC007415 NM_001035506  
HGE100161 M01C050G17 pDONR221 MGC14-E09 BC007415 NM_001035506  
HGE100209 M01C050I17 pDONR221 MGC14-E09 BC007415 NM_001035506  
HGE100257 M01C050K17 pDONR221 MGC14-E09 BC007415 NM_001035506  
HGE100305 M01C050M17 pDONR221 MGC14-E09 BC007415 NM_001035506  
HGE100353 M01C050O17 pDONR221 MGC14-E09 BC007415 NM_001035506  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR187327 ARi68F07 pGCAP10 NM_001035507.2  
GGCAGAGCGGGGTCCCGGCACCGCGGCGCTCGGGTGTTTTTGGGGGCCCGGGTGGAGGGC
HKR243784 ARiS109H16 pGCAP10 NM_001035507.2  
GAGAGCGGGGTCCCGGCACCGCGGCGCTCGGGTGTTTTTGGGGGCCCGGGTGGAGGGNAN
HKR370547 RBd26G03 pGCAP10 NM_001035507.2  
GGAGAGACTTCTTGTTTCCTGGCAGAGCGGGGTCCCGGCACCGCGGCGCTCGGGTGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl